User:Dmt brazil/temp test
This guide is provided for informational and educational purposes only. We do not encourage you to break the law and cannot claim any responsibility for your actions. |
This article is a stub. As such, it may contain incomplete or wrong information. You can help by expanding it. |

The use of Genetic engineering to create the Biosynthesis of DMT in modified organisms
Introduction
As of June 2017 nobody has ever made a modification in a organism to produce DMT.
This article contemplate the research that is going on in this subject.
Simplified steps to achieve the goal
- Choose a organism
- Discover genes involved biosynth
- write the plasmid
- Buy the plasmid
- Introduce the plasmid into the organisms
- Grow organisms
kill off organisms that did not assimilate the plasmid using a pencilin
- Dry the biomass and harvest it using straight to base, or similiar
Foruns discussions
There has been a lot of reseach on online forums on how to create a organism that produces dmt using genetic engineering. Here is a list of most important threads on this subject.
DMT-Nexus
- DMT-Nexus - 7/13/2008 what is the deal with genetic engineering? https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=1758
- DMT-Nexus - 12/10/2008 DIY Genetic Engineering & DMT production https://www.dmt-nexus.me/forum/default.aspx?g=posts&m=63238
- DMT-Nexus - 6/3/2008 a note on genetic engineering https://www.dmt-nexus.me/forum/default.aspx?g=posts&m=12907
- DMT-Nexus - 12/10/2008 - DMT and genetic engeneering https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=2892
- DMT-Nexus - 5/18/2011 - Genetically engineered DMT : https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=21752
- DMT-Nexus - 8/10/2013 - Biosynthesis of DMT by yeast? https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=47315
- DMT-Nexus - 7/22/2015 - Biosynthesis of DMT with modified e.coli : https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=66341
- DMT-Nexus - 12/14/2015 - GMO/Synthehuasca: Would You Take It? https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=68577
- DMT-Nexus - 4/5/2016 - Gene Modification for entheogen sustainability. https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=70324
- DMT-Nexus - 5/19/2011 - Biosynthesis of Novel Tryptamines Aspirations. https://www.dmt-nexus.me/forum/default.aspx?g=posts&t=21776
- reddit 2014 - Genetic Engineering and DMT production https://www.reddit.com/r/genetics/comments/1dhyk8/genetic_engineering_and_dmt_production/
- reddit 2016 - Biosynthesis of DMT with modified e.coli https://www.reddit.com/r/DMT/comments/3e36ck/biosynthesis_of_dmt_with_modified_ecoli/
shroomery
- shroomery - 05/26/05 - HOW TO MAKE ANY ORGANISM MAKE DMT/PSILOS https://www.shroomery.org/forums/showflat.php/Number/4227329#4227329
- shroomery - 12/27/12 - Genetically engineering psychedelic plants? https://www.shroomery.org/forums/showflat.php/Number/17455243#17455243
- shroomery - 02/21/06 - Psychedelics produced from GM yeasts - what's your opinion? https://www.shroomery.org/forums/showflat.php/Number/5323478
related projects
- Harvard scientists to make LSD factory from microbes : https://www.theguardian.com/science/blog/2011/jun/21/scientists-make-lsd-from-microbes
- Production of THC by genetically modified bacteria : http://www.cannabis-med.org/english/bulletin/ww_en_db_cannabis_artikel.php?id=329#1
- Nature.com Engineered yeast paves way for home-brew heroin : http://www.nature.com/news/engineered-yeast-paves-way-for-home-brew-heroin-1.17566
The theory - Research on how to do the modification
A the research needed to modify a organism
Biosynthesis of DMT in humans

Dimethyltryptamine is an indole alkaloid derived from the shikimate pathway.
the biosynthesis of DMT is relatively simple.
L-tryptophan is transformed in DMT the end of the process .
Humans cannot produce L-tryptophan, so we need to eat it. Tryptophan is a routine constituent of most protein-based foods or dietary proteins. It is particularly plentiful in milk, yogurt, cottage cheese, red meat, eggs, etc.
It begins with its decarboxylation (a chemical reaction that removes a carboxyl group and releases carbon dioxide (CO2)) of L-tryptophan by an aromatic amino acid decarboxylase (AADC) enzyme

(step 1). The resulting decarboxylated tryptophan analog is tryptamine.
Tryptamine then undergoes a transmethylation
(step 2): the enzyme indolethylamine-N-methyltransferase (INMT) catalyzes the transfer of a methyl group from cofactor S-adenosyl-methionine (SAM), via nucleophilic attack, to tryptamine.

This reaction transforms SAM into S-adenosylhomocysteine (SAH), and gives the intermediate product N-methyltryptamine (NMT).

[1][2] NMT is in turn transmethylated by the same process
(step 3) to form the end product N,N-dimethyltryptamine. Tryptamine transmethylation is regulated by two products of the reaction: SAH,[3][4][5] and DMT[3][5] were shown ex vivo to be among the most potent inhibitors of rabbit INMT activity.
This transmethylation mechanism has been repeatedly and consistently proven by radiolabeling of SAM methyl group with carbon-14 (14C-CH3)SAM).[1][3][5][6][7]
DMT and the human DNA
Dmt in humans is created with genes located in Chromosome 7.
Chromosome 7 is one of the 23 pairs of chromosomes in humans. Chromosome 7 spans about 158 million[8] base pairs (the building material of DNA) and represents between 5 and 5.5 percent of the total DNA in cells.
In January 2017, two estimates differed by 10%, with one estimate giving 2,774[9] genes, and the other estimate giving 2,500[10] genes.


EntrezGene = 21743 UniProt = P40936
- located in Chromosome 7 (human) https://www.ncbi.nlm.nih.gov/genome/gdv/browser/?context=gene&acc=11185
In enzymology, an Amine N-methyltransferase (Template:EC number) is an enzyme that is ubiquitously present in non-neural tissues and that catalyzes the N-methylation of tryptamine and structurally related compounds.[11]
The chemical reaction taking place is:
- S-adenosyl-L-methionine + an amine <math>\rightleftharpoons</math> S-adenosyl-L-homocysteine + a methylated amine
Thus, the two substrates of this enzyme are S-adenosyl methionine and amine, whereas its two products are S-adenosylhomocysteine and methylated amine. In the case of tryptamine and serotonin these then become the dimethylated indolethylamines dimethyltryptamine (DMT) and bufotenine.[12]
This enzyme belongs to the family of transferases, specifically those transferring one-carbon group methyltransferases. The systematic name of this enzyme class is S-adenosyl-L-methionine:amine N-methyltransferase. Other names in common use include nicotine N-methyltransferase, tryptamine N-methyltransferase, indolethylamine N-methyltransferase, and arylamine N-methyltransferase. This enzyme participates in tryptophan metabolism.
A wide range of primary, secondary and tertiary amines can act as acceptors, including tryptamine, aniline, nicotine and a variety of drugs and other xenobiotics.[11]
N-methylation of endogenous and xenobiotic compounds is a major method by which they are degraded. This gene encodes an enzyme that N-methylates indoles such as tryptamine. Alternative splicing results in multiple transcript variants. Read-through transcription also exists between this gene and the downstream FAM188B (family with sequence similarity 188, member B) gene. [provided by RefSeq, Nov 2010]
enzyme encoded into DNA
atggaggggaaagtctatatcgggggggagttctatgagaaagagttcacacccaaattc tatctgacaacatattatagcttccatagcgggcccgtcgccgagcaagagatcgtcaaa ttcagcctgcaaaatctgtatcaaacattcagcacagggggggtcggggggttcgtcctg atcttcatcgggagcgggcccacaatctatcaactgctgagcgcctgcgaggtcttcaga gagatcatcgtcacattctatacaccccaaaatctgcaagagctgcaaaaatggctgaaa aaagagcccggggcctatttctggagcagcatcgtccaacatgcctgcgagctggagggg ttcagaagcagatggcaagagaaagaggccaaactgagaagaacagtcacaagagtcctg agatgcttcgtcacaaaaacaccccccctggggagcgcccaagtccccctggccttctgc gtcctgacattcctggccatggagtgcgcctgccccttcatcttcacatatagagccgcc ctgagaagactggccgggctgctgaaacccggggggcatctggtcacactggtcacactg agattccaacattatatggtcgggcccaaaaaattcagcggggtctatctggagaaagag gtcgtcgagaaagccatccaattcgccgggtgccaagtcctgaaatgcaattgcgtcagc ctgagctatagcgaggcctattgcagccatttcgggctgtgcttcgtcgtcgccagaaaa gggcccagc
DNA above is two steps away from the translation done by the ribosome. DNA is transcribed into RNA by DNA transcriptase, RNA is translated into proteins by ribosomes. But we are interested in the DNA that we can put into the organism, so that is why I worked my way backwards to DNA.

http://www.uniprot.org/uniprot/O88533
Template:Enzyme Template:Infobox protein Aromatic L-amino acid decarboxylase (AADC or AAAD), also known as DOPA decarboxylase, tryptophan decarboxylase, and 5-hydroxytryptophan decarboxylase, is a lyase enzyme (Template:EC number).
Reactions
AADC catalyzes several different decarboxylation reactions:[13]
- L-DOPA to dopamine - a neurotransmitter
- 5-HTP to serotonin (5-HT) - a neurotransmitter
- L-histidine to histamine - a neurotransmitter
- phenylalanine to phenethylamine - a trace amine neuromodulator
- L-tyrosine to tyramine - a trace amine neuromodulator
- tryptophan to tryptamine - a trace amine neuromodulator
The enzyme uses pyridoxal phosphate, the active form of vitamin B6, as a cofactor. Template:Phenylalanine biosynthesis
- Below is the DNA sequence that codes for the protein above
atgttcagcagagagttcagaagaagagggaaagagatggtcttctatatcgccttctat ctgttcgggatcgaggggagacccgtctatcccttcgtcgagcccgggtatctgagaccc
ctgatccccgccacagccccccaagagcccgagacatatgagttcatcatcaaattcatc gagaaaatcatcatgcccggggtcacacattggcatagcccctatttcttcgcctatttc cccacagccagcagctatcccgccatgctggccttcatgctgtgcggggccatcgggtgc atcgggttcagctgggccgccagccccgcctgcacagagctggagacagtcatgatgttc tggctggggaaaatgctggagctgcccgaggccttcctggccgggagagccggggagggg gggggggtcatccaagggagcgccagcgaggccacactggtcgccctgctggccgccaga acaaaagtcatcagacaactgcaagccgccagccccgagttcacacaagccgccatcatg gagaaactggtcgcctatacaagcttccaagcccatagcagcgtcgagagagccgggctg atcggggggatcaaactgaaagccgtccccagcttcgggaatttcagcatgagagccagc gccctgagagaggccctggagagattcaaagccgccgggctgatccccttcttcgtcgtc gccacactggggacaacaagctgctgcagcttcttcaatctgctggaggtcgggcccatc tgcaatcaagagggggtctggctgcatatcttcgccgcctatgccgggagcgccttcatc tgccccgagttcagatatctgctgaatggggtcgagttcgccttcagcttcaatttcaat ccccataaatggctgctggtcaatttcttctgcagcgccatgtgggtcaaaagaagaaca ttcctgacaggggccttcaatatgttccccgtctatctgaaacatagccatcaattcagc gggttcatcacattctatagacattggcaaatccccctggggagaagattcagaagcctg aaaatgtggttcgtcttcagaatgtatggggtcaaagggctgcaagcctatatcagaaaa catgtcgagctgagccatgagttcgagagcctggtcagacaattccccagattcgagatc tgcacagaggtcatcctggggctggtctgcttcagactgaaagggagcaatgagctgaat gagacactgctgcaaagaatcaatagcgccaaaaaaatccatctggtcccctgcagactg agattcaaattcgtcctgagattcgccgtctgcgccagaacagtcgagagcgcccatgtc caactggcctgggagcatatcagcttcctggccagcagcgtcctgagagccgagaaagag
Construct a digital plasmid
learning the science
- Get the very basics: https://en.wikipedia.org/wiki/Central_dogma_of_molecular_biology
- Coding for proteins: https://en.wikipedia.org/wiki/Genetic_code#DNA_codon_table
- The FASTA-format, used to describe proteins and other: https://en.wikipedia.org/wiki/FASTA_format
- Standard template genes: http://parts.igem.org/Catalog
- For help with understanding terminator genes: http://www.entelechon.com/2008/09/rna-secondary-structure/
- Genome and metabolic pathways of E. coli (IMPORTANT!): http://ecocyc.org/ and http://biocyc.org/
The basic idea is to extend the metabolic pathway of e coli by inserting new genes into it. The genes code for proteins that make it happen (exactly like described in https://en.wikipedia.org/wiki/N,N-Dimethyltryptamine#Biosynthesis). It is possible to buy synthetic genes on plasmids from the internet for a few hundred dollars. Plasmids are circular strings of DNA that, when bought from synthesizers also often encode for resistance against some form of antibiotics, such as amplifilin. The idea is that after you have inserted the plasmid into a colony of E. coli, you add the antibiotic specific to the plasmid in order to kill off all individual organisms that did not absorb the plasmid. Insertion of genes with the help of a plasmid vector is very well described and can be done in a kitchen. There are youtube tutorials. For example, https://www.youtube.com/watch?v=slY4qrnZIM8.
L-Tryptophan, one of the 22 essential amino-acids (which exist in all living bodies), is transformed into DMT through interaction with two enzymes: AAAD (Aromatic L-amino acid decarboxylase) and INMT (Amine N-methyltransferase).
E. coli lacks both these enzymes.
These enzymes consume co-enzymes that are available in the e.coli.
(You can look up the available chemicals in e coli and their relationship with its genome by using ecocyc.org or biocyc.org.)
If E.coli contained AAAD and INMT, they would interact with other chemicals present in the cell and produce new chemicals. Going through the list of all chemicals that can interact with the two enzymes, I found that AAAD would produce the phenetylamine and tyramine as a by-product. This is important, as ingesting tyramine in combination with a mono-amine oxidase inhibitor (MAOI) could cause hypertensive crisis. This could be lethal to a psychedelic user ingesting the product.
I took the code for the enzymes from uniprot.org and compiled them into the DNA. For procaryotes this means that one simply translated each amino-acid into codons (DNA-basepair triplets) that code for them.
The other parts it took from the biobricks project: An annual competition held by universities to teach students to genetically modify organisms into doing various mostly useful things. (http://parts.igem.org/Catalog?title=Catalog) The biobricks project is also quite a useful place to start off ones own studies, its very pedagogical.
The central dogma of genetics is that DNA is transcribed into RNA, that is then translated into sequences of amino-acids. These sequences are proteins, and enzymes are proteins.
BBa_I14033
http://parts.igem.org/Part:BBa_I14033
http://beta.labgeni.us/registries/parts_registry/?part=BBa_I14033
promoter [code] >BBa_I14033 Part-only sequence. Constitutive Promoter, Medium Transcription (38 bp)
ggcacgtaagaggttccaactttcaccataatgaaaca
[/code]
The promoter recruits transcriptional machinery, that attach to the DNA and transcribes it into mRNA. The transcription strength is perhaps one of the most important knobs one could experiment with. Too high transcription would result in too much of the organisms metabolic system being kidnapped for the manufacture of enzymes, which would slow growth. A too low transcription would result in an organism that does not produce enough amounts of DMT.
BBa_B0029
http://parts.igem.org/Part:BBa_B0029
Ribosome Binding Site (RBS) [code] >BBa_B0029 Part-only sequence (15 bp) ttcacacaggaaacc [/code]
The RBS binds the mRNA to ribosomes, that translates the mRNA into amino acids.
The rest of the gene below, with the exception of the terminator, is code that will be translated into enzymes. Both enzymes start with methodine, which is also a start-codon. This means that no "cutting and pasting" is needed. Between the code that translates to the enzymes, there are stop codons and a spacer that does not initiate translation.
spacer 1
Makes the ribosome stop translation. The ribosome continues its travel down the single-helix RNA though, so it will encounter the next enzyme-encoding sequence as well.
[code] > spacer actgtattccta [/code]
Does nothing at all, just to separate the proteins in space, and give the ribosome a chance to properly emit the INMT before beginning on the AAAD.
Stop codon tagtag
BBa_B0012
Terminates translation and makes the ribosome emit the protein.
[code] >BBa_B0012 Part-only sequence (41 bp) tcacactggctcaccttcgggtgggcctttctgcgtttata [/code]
Terminator that forms a physical loop out of the single-helix RNA equivalent. The loop is formed by the palindrome contained within the sequence. Read more about it at biobricks wiki under the topic terminators.
Final
The whole sequence looks like this:
ggcacgtaagaggttccaactttcaccataatgaaacattcacacagga aaccatggaggggaaagtctatatcgggggggagttctatgagaaagag ttcacacccaaattctatctgacaacatattatagcttccatagcgggc ccgtcgccgagcaagagatcgtcaaattcagcctgcaaaatctgtatca aacattcagcacagggggggtcggggggttcgtcctgatcttcatcggg agcgggcccacaatctatcaactgctgagcgcctgcgaggtcttcagag agatcatcgtcacattctatacaccccaaaatctgcaagagctgcaaaa atggctgaaaaaagagcccggggcctatttctggagcagcatcgtccaa catgcctgcgagctggaggggttcagaagcagatggcaagagaaagagg ccaaactgagaagaacagtcacaagagtcctgagatgcttcgtcacaaa aacaccccccctggggagcgcccaagtccccctggccttctgcgtcctg acattcctggccatggagtgcgcctgccccttcatcttcacatatagag ccgccctgagaagactggccgggctgctgaaacccggggggcatctggt cacactggtcacactgagattccaacattatatggtcgggcccaaaaaa ttcagcggggtctatctggagaaagaggtcgtcgagaaagccatccaat tcgccgggtgccaagtcctgaaatgcaattgcgtcagcctgagctatag cgaggcctattgcagccatttcgggctgtgcttcgtcgtcgccagaaaa gggcccagctagtagactgtattcctaatgttcagcagagagttcagaa gaagagggaaagagatggtcttctatatcgccttctatctgttcgggat cgaggggagacccgtctatcccttcgtcgagcccgggtatctgagaccc ctgatccccgccacagccccccaagagcccgagacatatgagttcatca tcaaattcatcgagaaaatcatcatgcccggggtcacacattggcatag cccctatttcttcgcctatttccccacagccagcagctatcccgccatg ctggccttcatgctgtgcggggccatcgggtgcatcgggttcagctggg ccgccagccccgcctgcacagagctggagacagtcatgatgttctggct ggggaaaatgctggagctgcccgaggccttcctggccgggagagccggg gagggggggggggtcatccaagggagcgccagcgaggccacactggtcg ccctgctggccgccagaacaaaagtcatcagacaactgcaagccgccag ccccgagttcacacaagccgccatcatggagaaactggtcgcctataca agcttccaagcccatagcagcgtcgagagagccgggctgatcgggggga tcaaactgaaagccgtccccagcttcgggaatttcagcatgagagccag cgccctgagagaggccctggagagattcaaagccgccgggctgatcccc ttcttcgtcgtcgccacactggggacaacaagctgctgcagcttcttca atctgctggaggtcgggcccatctgcaatcaagagggggtctggctgca tatcttcgccgcctatgccgggagcgccttcatctgccccgagttcaga tatctgctgaatggggtcgagttcgccttcagcttcaatttcaatcccc ataaatggctgctggtcaatttcttctgcagcgccatgtgggtcaaaag aagaacattcctgacaggggccttcaatatgttccccgtctatctgaaa catagccatcaattcagcgggttcatcacattctatagacattggcaaa tccccctggggagaagattcagaagcctgaaaatgtggttcgtcttcag aatgtatggggtcaaagggctgcaagcctatatcagaaaacatgtcgag ctgagccatgagttcgagagcctggtcagacaattccccagattcgaga tctgcacagaggtcatcctggggctggtctgcttcagactgaaagggag caatgagctgaatgagacactgctgcaaagaatcaatagcgccaaaaaa atccatctggtcccctgcagactgagattcaaattcgtcctgagattcg ccgtctgcgccagaacagtcgagagcgcccatgtccaactggcctggga gcatatcagcttcctggccagcagcgtcctgagagccgagaaagagtag tagtcacactggctcaccttcgggtgggcctttctgcgtttata
Appling the theory to actually modify a organism
Buy the gene on a plasmid from some online shop
with the knowledge of the genes needed to produce DMT you have to send it to a Online shops selling synthetic DNA and buy it on a plasmid.
Online shops selling synthetic DNA:
- http://www.plasmid.com/
- http://www.genscript.com/gene_synthesis.html
- http://www.genewiz.com/public/gene-synthesis.aspx
- https://www.youtube.com/watch?v=lNttxYdGHs4
- Plasmids and Recombinant DNA Technology https://www.youtube.com/watch?v=2YxTcBimxlw
Introduce the plasmid into a population of chosen organisms
with the plasmid in hands you have to introduce it on a organism like e.coli
Grow organisms assimilate the plasmid
kill off organisms that did not assimilate the plasmid using a pencilin
Dry the biomass and harvest it using straight to base, or similiar
using some of Tek Extractions
- ↑ 1.0 1.1 Axelrod J. (August 1961). "Enzymatic formation of psychotomimetic metabolites from normally occurring compounds". Science. 134 (3475): 343. doi:10.1126/science.134.3475.343. PMID 13685339.
- ↑ Rosengarten H.; Friedhoff A.J. (1976). "A review of recent studies of the biosynthesis and excretion of hallucinogens formed by methylation of neurotransmitters or related substances" (PDF). Schizophrenia Bulletin. 2 (1): 90–105. doi:10.1093/schbul/2.1.90. PMID 779022.
- ↑ 3.0 3.1 3.2 Barker S.A.; Monti J.A.; Christian S.T. (1981). "N, N-dimethyltryptamine: an endogenous hallucinogen". International Review of Neurobiology. International Review of Neurobiology. 22: 83–110. doi:10.1016/S0074-7742(08)60291-3. ISBN 978-0-12-366822-6. PMID 6792104.
- ↑ Lin R.L.; Narasimhachari N.; Himwich H.E. (September 1973). "Inhibition of indolethylamine-N-methyltransferase by S-adenosylhomocysteine". Biochemical and Biophysical Research Communications. 54 (2): 751–9. doi:10.1016/0006-291X(73)91487-3. PMID 4756800.
- ↑ 5.0 5.1 5.2 Thompson M.A.; Weinshilboum R.M. (December 1998). "Rabbit lung indolethylamine N-methyltransferase. cDNA and gene cloning and characterization". Journal of Biological Chemistry. 273 (51): 34502–10. doi:10.1074/jbc.273.51.34502. PMID 9852119. Retrieved 2010-11-09.
- ↑ Mandel L.R.; Prasad R.; Lopez-Ramos B.; Walker R.W. (January 1977). "The biosynthesis of dimethyltryptamine in vivo". Research Communications in Chemical Pathology and Pharmacology. 16 (1): 47–58. PMID 14361.
- ↑ Thompson M.A.; Moon E.; Kim U.J.; Xu J.; Siciliano M.J.; Weinshilboum R.M. (November 1999). "Human indolethylamine N-methyltransferase: cDNA cloning and expression, gene cloning, and chromosomal localization" (PDF). Genomics. 61 (3): 285–97. doi:10.1006/geno.1999.5960. PMID 10552930.
- ↑ What is chromosome 7, "Genetics Home Reference" of U.S. National Library of Medicine. April 2008. [2014-05-14].
- ↑ "Homo sapiens (human) Chromosome 7". NCBI Map Viewer. National Center for Biotechnology Information. Retrieved January 20, 2017.
- ↑ "Homo sapiens: Chromosome summary: Chromosome 7:1-159345973". Wellcome Trust Sanger Institute. Vega Genome Browser 58. Retrieved January 20, 2017.
- ↑ 11.0 11.1 Template:MeshName
- ↑ J., Kärkkäinen; T. Forsström; J. Tornaeus; K. Wähälä; P. Kiuru; A. Honkanen; U. -H. Stenman; U. Turpeinen; A. Hesso (April 2005). "Potentially hallucinogenic 5-hydroxytryptamine receptor ligands bufotenine and dimethyltryptamine in blood and tissues". Scandinavian Journal of Clinical and Laboratory Investigation. 65 (3): 189–199. doi:10.1080/00365510510013604. PMID 16095048. Retrieved October 15, 2008.
- ↑ "AADC". Human Metabolome database. Retrieved 17 February 2015.